CoBRA WebServer
Check Job

Submit RNA Sequence for Binding Site Prediction

Valid nucleotides: A, U, G, C | Max length per sequence: 161 nt

>example_rna GGACAUACAAUCGCGUGGAUAUGGCACGCAAGAUC

Accepted formats: .fasta, .fa, .txt | Multiple sequences allowed

RNA sequence will be extracted from the selected chain automatically.

About CoBRA

  • CoBRA predicts RNA-protein binding sites at nucleotide resolution
  • Uses RiNALMo embeddings for sequence representation
  • Output: Binary prediction (1 = binding site, 0 = non-binding)
  • Sequence length limit: 5-161 nucleotides per sequence
CoBRA - RNA Binding Site Prediction | Powered by RiNALMo